ID: 971909139

View in Genome Browser
Species Human (GRCh38)
Location 4:32772238-32772260
Sequence GGAAACAGTAGTCAAAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971909139_971909144 27 Left 971909139 4:32772238-32772260 CCTTCCCTTTGACTACTGTTTCC No data
Right 971909144 4:32772288-32772310 ATTCCTCATTAGAGAAACCCAGG No data
971909139_971909145 28 Left 971909139 4:32772238-32772260 CCTTCCCTTTGACTACTGTTTCC No data
Right 971909145 4:32772289-32772311 TTCCTCATTAGAGAAACCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971909139 Original CRISPR GGAAACAGTAGTCAAAGGGA AGG (reversed) Intergenic
No off target data available for this crispr