ID: 971909140

View in Genome Browser
Species Human (GRCh38)
Location 4:32772242-32772264
Sequence GACAGGAAACAGTAGTCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971909140_971909144 23 Left 971909140 4:32772242-32772264 CCCTTTGACTACTGTTTCCTGTC No data
Right 971909144 4:32772288-32772310 ATTCCTCATTAGAGAAACCCAGG No data
971909140_971909145 24 Left 971909140 4:32772242-32772264 CCCTTTGACTACTGTTTCCTGTC No data
Right 971909145 4:32772289-32772311 TTCCTCATTAGAGAAACCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971909140 Original CRISPR GACAGGAAACAGTAGTCAAA GGG (reversed) Intergenic
No off target data available for this crispr