ID: 971909141

View in Genome Browser
Species Human (GRCh38)
Location 4:32772243-32772265
Sequence GGACAGGAAACAGTAGTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971909141_971909145 23 Left 971909141 4:32772243-32772265 CCTTTGACTACTGTTTCCTGTCC No data
Right 971909145 4:32772289-32772311 TTCCTCATTAGAGAAACCCAGGG No data
971909141_971909144 22 Left 971909141 4:32772243-32772265 CCTTTGACTACTGTTTCCTGTCC No data
Right 971909144 4:32772288-32772310 ATTCCTCATTAGAGAAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971909141 Original CRISPR GGACAGGAAACAGTAGTCAA AGG (reversed) Intergenic
No off target data available for this crispr