ID: 971909143

View in Genome Browser
Species Human (GRCh38)
Location 4:32772264-32772286
Sequence AAGTACAGACACTAATTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971909143_971909145 2 Left 971909143 4:32772264-32772286 CCTCATAATTAGTGTCTGTACTT No data
Right 971909145 4:32772289-32772311 TTCCTCATTAGAGAAACCCAGGG No data
971909143_971909150 18 Left 971909143 4:32772264-32772286 CCTCATAATTAGTGTCTGTACTT No data
Right 971909150 4:32772305-32772327 CCCAGGGCCTTCTGGGAAGTAGG No data
971909143_971909144 1 Left 971909143 4:32772264-32772286 CCTCATAATTAGTGTCTGTACTT No data
Right 971909144 4:32772288-32772310 ATTCCTCATTAGAGAAACCCAGG No data
971909143_971909147 10 Left 971909143 4:32772264-32772286 CCTCATAATTAGTGTCTGTACTT No data
Right 971909147 4:32772297-32772319 TAGAGAAACCCAGGGCCTTCTGG No data
971909143_971909148 11 Left 971909143 4:32772264-32772286 CCTCATAATTAGTGTCTGTACTT No data
Right 971909148 4:32772298-32772320 AGAGAAACCCAGGGCCTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971909143 Original CRISPR AAGTACAGACACTAATTATG AGG (reversed) Intergenic
No off target data available for this crispr