ID: 971909144

View in Genome Browser
Species Human (GRCh38)
Location 4:32772288-32772310
Sequence ATTCCTCATTAGAGAAACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971909142_971909144 6 Left 971909142 4:32772259-32772281 CCTGTCCTCATAATTAGTGTCTG No data
Right 971909144 4:32772288-32772310 ATTCCTCATTAGAGAAACCCAGG No data
971909143_971909144 1 Left 971909143 4:32772264-32772286 CCTCATAATTAGTGTCTGTACTT No data
Right 971909144 4:32772288-32772310 ATTCCTCATTAGAGAAACCCAGG No data
971909141_971909144 22 Left 971909141 4:32772243-32772265 CCTTTGACTACTGTTTCCTGTCC No data
Right 971909144 4:32772288-32772310 ATTCCTCATTAGAGAAACCCAGG No data
971909140_971909144 23 Left 971909140 4:32772242-32772264 CCCTTTGACTACTGTTTCCTGTC No data
Right 971909144 4:32772288-32772310 ATTCCTCATTAGAGAAACCCAGG No data
971909139_971909144 27 Left 971909139 4:32772238-32772260 CCTTCCCTTTGACTACTGTTTCC No data
Right 971909144 4:32772288-32772310 ATTCCTCATTAGAGAAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971909144 Original CRISPR ATTCCTCATTAGAGAAACCC AGG Intergenic
No off target data available for this crispr