ID: 971909146

View in Genome Browser
Species Human (GRCh38)
Location 4:32772291-32772313
Sequence GGCCCTGGGTTTCTCTAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971909146_971909153 7 Left 971909146 4:32772291-32772313 CCTCATTAGAGAAACCCAGGGCC No data
Right 971909153 4:32772321-32772343 AAGTAGGAAGTTCTGAATTTTGG No data
971909146_971909155 9 Left 971909146 4:32772291-32772313 CCTCATTAGAGAAACCCAGGGCC No data
Right 971909155 4:32772323-32772345 GTAGGAAGTTCTGAATTTTGGGG No data
971909146_971909156 20 Left 971909146 4:32772291-32772313 CCTCATTAGAGAAACCCAGGGCC No data
Right 971909156 4:32772334-32772356 TGAATTTTGGGGCAGAGAAGAGG No data
971909146_971909154 8 Left 971909146 4:32772291-32772313 CCTCATTAGAGAAACCCAGGGCC No data
Right 971909154 4:32772322-32772344 AGTAGGAAGTTCTGAATTTTGGG No data
971909146_971909150 -9 Left 971909146 4:32772291-32772313 CCTCATTAGAGAAACCCAGGGCC No data
Right 971909150 4:32772305-32772327 CCCAGGGCCTTCTGGGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971909146 Original CRISPR GGCCCTGGGTTTCTCTAATG AGG (reversed) Intergenic
No off target data available for this crispr