ID: 971909147

View in Genome Browser
Species Human (GRCh38)
Location 4:32772297-32772319
Sequence TAGAGAAACCCAGGGCCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971909143_971909147 10 Left 971909143 4:32772264-32772286 CCTCATAATTAGTGTCTGTACTT No data
Right 971909147 4:32772297-32772319 TAGAGAAACCCAGGGCCTTCTGG No data
971909142_971909147 15 Left 971909142 4:32772259-32772281 CCTGTCCTCATAATTAGTGTCTG No data
Right 971909147 4:32772297-32772319 TAGAGAAACCCAGGGCCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971909147 Original CRISPR TAGAGAAACCCAGGGCCTTC TGG Intergenic
No off target data available for this crispr