ID: 971909150

View in Genome Browser
Species Human (GRCh38)
Location 4:32772305-32772327
Sequence CCCAGGGCCTTCTGGGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971909143_971909150 18 Left 971909143 4:32772264-32772286 CCTCATAATTAGTGTCTGTACTT No data
Right 971909150 4:32772305-32772327 CCCAGGGCCTTCTGGGAAGTAGG No data
971909146_971909150 -9 Left 971909146 4:32772291-32772313 CCTCATTAGAGAAACCCAGGGCC No data
Right 971909150 4:32772305-32772327 CCCAGGGCCTTCTGGGAAGTAGG No data
971909142_971909150 23 Left 971909142 4:32772259-32772281 CCTGTCCTCATAATTAGTGTCTG No data
Right 971909150 4:32772305-32772327 CCCAGGGCCTTCTGGGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971909150 Original CRISPR CCCAGGGCCTTCTGGGAAGT AGG Intergenic
No off target data available for this crispr