ID: 971911399

View in Genome Browser
Species Human (GRCh38)
Location 4:32800777-32800799
Sequence GAATGGACACAAGTTCAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971911399_971911402 0 Left 971911399 4:32800777-32800799 CCAAATTGAACTTGTGTCCATTC No data
Right 971911402 4:32800800-32800822 CAGAAGATAGCTGACAAAGATGG No data
971911399_971911403 3 Left 971911399 4:32800777-32800799 CCAAATTGAACTTGTGTCCATTC No data
Right 971911403 4:32800803-32800825 AAGATAGCTGACAAAGATGGAGG No data
971911399_971911404 18 Left 971911399 4:32800777-32800799 CCAAATTGAACTTGTGTCCATTC No data
Right 971911404 4:32800818-32800840 GATGGAGGAACAATGAGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971911399 Original CRISPR GAATGGACACAAGTTCAATT TGG (reversed) Intergenic
No off target data available for this crispr