ID: 971914632

View in Genome Browser
Species Human (GRCh38)
Location 4:32851708-32851730
Sequence CAACCTACTGACACCAGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971914632_971914634 -3 Left 971914632 4:32851708-32851730 CCCTGGCTGGTGTCAGTAGGTTG No data
Right 971914634 4:32851728-32851750 TTGCATGCCCCCAAGTTCACTGG No data
971914632_971914639 21 Left 971914632 4:32851708-32851730 CCCTGGCTGGTGTCAGTAGGTTG No data
Right 971914639 4:32851752-32851774 TCTGAGCTTAATTCATCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971914632 Original CRISPR CAACCTACTGACACCAGCCA GGG (reversed) Intergenic
No off target data available for this crispr