ID: 971914634

View in Genome Browser
Species Human (GRCh38)
Location 4:32851728-32851750
Sequence TTGCATGCCCCCAAGTTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971914630_971914634 0 Left 971914630 4:32851705-32851727 CCACCCTGGCTGGTGTCAGTAGG No data
Right 971914634 4:32851728-32851750 TTGCATGCCCCCAAGTTCACTGG No data
971914628_971914634 7 Left 971914628 4:32851698-32851720 CCCTTAGCCACCCTGGCTGGTGT No data
Right 971914634 4:32851728-32851750 TTGCATGCCCCCAAGTTCACTGG No data
971914629_971914634 6 Left 971914629 4:32851699-32851721 CCTTAGCCACCCTGGCTGGTGTC No data
Right 971914634 4:32851728-32851750 TTGCATGCCCCCAAGTTCACTGG No data
971914632_971914634 -3 Left 971914632 4:32851708-32851730 CCCTGGCTGGTGTCAGTAGGTTG No data
Right 971914634 4:32851728-32851750 TTGCATGCCCCCAAGTTCACTGG No data
971914633_971914634 -4 Left 971914633 4:32851709-32851731 CCTGGCTGGTGTCAGTAGGTTGC No data
Right 971914634 4:32851728-32851750 TTGCATGCCCCCAAGTTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971914634 Original CRISPR TTGCATGCCCCCAAGTTCAC TGG Intergenic
No off target data available for this crispr