ID: 971914639

View in Genome Browser
Species Human (GRCh38)
Location 4:32851752-32851774
Sequence TCTGAGCTTAATTCATCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971914638_971914639 -9 Left 971914638 4:32851738-32851760 CCAAGTTCACTGGCTCTGAGCTT No data
Right 971914639 4:32851752-32851774 TCTGAGCTTAATTCATCCTTTGG No data
971914636_971914639 -7 Left 971914636 4:32851736-32851758 CCCCAAGTTCACTGGCTCTGAGC No data
Right 971914639 4:32851752-32851774 TCTGAGCTTAATTCATCCTTTGG No data
971914635_971914639 -6 Left 971914635 4:32851735-32851757 CCCCCAAGTTCACTGGCTCTGAG 0: 5
1: 32
2: 82
3: 185
4: 421
Right 971914639 4:32851752-32851774 TCTGAGCTTAATTCATCCTTTGG No data
971914637_971914639 -8 Left 971914637 4:32851737-32851759 CCCAAGTTCACTGGCTCTGAGCT No data
Right 971914639 4:32851752-32851774 TCTGAGCTTAATTCATCCTTTGG No data
971914630_971914639 24 Left 971914630 4:32851705-32851727 CCACCCTGGCTGGTGTCAGTAGG No data
Right 971914639 4:32851752-32851774 TCTGAGCTTAATTCATCCTTTGG No data
971914629_971914639 30 Left 971914629 4:32851699-32851721 CCTTAGCCACCCTGGCTGGTGTC No data
Right 971914639 4:32851752-32851774 TCTGAGCTTAATTCATCCTTTGG No data
971914632_971914639 21 Left 971914632 4:32851708-32851730 CCCTGGCTGGTGTCAGTAGGTTG No data
Right 971914639 4:32851752-32851774 TCTGAGCTTAATTCATCCTTTGG No data
971914633_971914639 20 Left 971914633 4:32851709-32851731 CCTGGCTGGTGTCAGTAGGTTGC No data
Right 971914639 4:32851752-32851774 TCTGAGCTTAATTCATCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971914639 Original CRISPR TCTGAGCTTAATTCATCCTT TGG Intergenic
No off target data available for this crispr