ID: 971919650

View in Genome Browser
Species Human (GRCh38)
Location 4:32921014-32921036
Sequence AGACACAATGGGCAGTTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971919650_971919654 18 Left 971919650 4:32921014-32921036 CCTGTTAACTGCCCATTGTGTCT No data
Right 971919654 4:32921055-32921077 CCTAAAACCATCTGACTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971919650 Original CRISPR AGACACAATGGGCAGTTAAC AGG (reversed) Intergenic
No off target data available for this crispr