ID: 971921667

View in Genome Browser
Species Human (GRCh38)
Location 4:32948302-32948324
Sequence TTTGGTTCCATATGAATTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 7619
Summary {0: 539, 1: 941, 2: 1416, 3: 1981, 4: 2742}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971921667_971921673 27 Left 971921667 4:32948302-32948324 CCTAAAATTCATATGGAACCAAA 0: 539
1: 941
2: 1416
3: 1981
4: 2742
Right 971921673 4:32948352-32948374 AAGCAGAAGAGCAAATCTGGAGG No data
971921667_971921668 -8 Left 971921667 4:32948302-32948324 CCTAAAATTCATATGGAACCAAA 0: 539
1: 941
2: 1416
3: 1981
4: 2742
Right 971921668 4:32948317-32948339 GAACCAAAAAAAGCCTACATAGG No data
971921667_971921672 24 Left 971921667 4:32948302-32948324 CCTAAAATTCATATGGAACCAAA 0: 539
1: 941
2: 1416
3: 1981
4: 2742
Right 971921672 4:32948349-32948371 ACTAAGCAGAAGAGCAAATCTGG No data
971921667_971921670 1 Left 971921667 4:32948302-32948324 CCTAAAATTCATATGGAACCAAA 0: 539
1: 941
2: 1416
3: 1981
4: 2742
Right 971921670 4:32948326-32948348 AAAGCCTACATAGGTAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971921667 Original CRISPR TTTGGTTCCATATGAATTTT AGG (reversed) Intergenic
Too many off-targets to display for this crispr