ID: 971921670

View in Genome Browser
Species Human (GRCh38)
Location 4:32948326-32948348
Sequence AAAGCCTACATAGGTAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971921667_971921670 1 Left 971921667 4:32948302-32948324 CCTAAAATTCATATGGAACCAAA 0: 539
1: 941
2: 1416
3: 1981
4: 2742
Right 971921670 4:32948326-32948348 AAAGCCTACATAGGTAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971921670 Original CRISPR AAAGCCTACATAGGTAAAGC AGG Intergenic
No off target data available for this crispr