ID: 971923298

View in Genome Browser
Species Human (GRCh38)
Location 4:32971747-32971769
Sequence GGGTGCTGCAGCTGAGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971923298_971923299 -4 Left 971923298 4:32971747-32971769 CCATCTGCTCAGCTGCAGCACCC No data
Right 971923299 4:32971766-32971788 ACCCAAAAAGCCTTCTTCCCTGG No data
971923298_971923305 21 Left 971923298 4:32971747-32971769 CCATCTGCTCAGCTGCAGCACCC No data
Right 971923305 4:32971791-32971813 ATACTTGCTGTCTCAGTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971923298 Original CRISPR GGGTGCTGCAGCTGAGCAGA TGG (reversed) Intergenic
No off target data available for this crispr