ID: 971924471

View in Genome Browser
Species Human (GRCh38)
Location 4:32989628-32989650
Sequence CTACACTAAACAATAATGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971924468_971924471 14 Left 971924468 4:32989591-32989613 CCAGCTGATTCTGATTTATGCTA No data
Right 971924471 4:32989628-32989650 CTACACTAAACAATAATGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971924471 Original CRISPR CTACACTAAACAATAATGGT GGG Intergenic
No off target data available for this crispr