ID: 971928239

View in Genome Browser
Species Human (GRCh38)
Location 4:33042834-33042856
Sequence CCTATTAAACACAATGATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971928239_971928241 30 Left 971928239 4:33042834-33042856 CCTCAATCATTGTGTTTAATAGG No data
Right 971928241 4:33042887-33042909 CAATTTTACAGTTCTGTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971928239 Original CRISPR CCTATTAAACACAATGATTG AGG (reversed) Intergenic
No off target data available for this crispr