ID: 971936018

View in Genome Browser
Species Human (GRCh38)
Location 4:33148559-33148581
Sequence AAAGCAGCTGAGATTTGAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971936018_971936022 15 Left 971936018 4:33148559-33148581 CCTATTCAAATCTCAGCTGCTTT No data
Right 971936022 4:33148597-33148619 TTTCATGTTACTGCTTACTAGGG No data
971936018_971936021 14 Left 971936018 4:33148559-33148581 CCTATTCAAATCTCAGCTGCTTT No data
Right 971936021 4:33148596-33148618 CTTTCATGTTACTGCTTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971936018 Original CRISPR AAAGCAGCTGAGATTTGAAT AGG (reversed) Intergenic
No off target data available for this crispr