ID: 971938968

View in Genome Browser
Species Human (GRCh38)
Location 4:33189411-33189433
Sequence CCTGTGACACCTGCTGGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971938968_971938987 20 Left 971938968 4:33189411-33189433 CCCCCACCAGCAGGTGTCACAGG No data
Right 971938987 4:33189454-33189476 CTCAGGGTGGTGGGCTACAGAGG No data
971938968_971938984 11 Left 971938968 4:33189411-33189433 CCCCCACCAGCAGGTGTCACAGG No data
Right 971938984 4:33189445-33189467 CTGGCAGCCCTCAGGGTGGTGGG No data
971938968_971938983 10 Left 971938968 4:33189411-33189433 CCCCCACCAGCAGGTGTCACAGG No data
Right 971938983 4:33189444-33189466 CCTGGCAGCCCTCAGGGTGGTGG No data
971938968_971938989 24 Left 971938968 4:33189411-33189433 CCCCCACCAGCAGGTGTCACAGG No data
Right 971938989 4:33189458-33189480 GGGTGGTGGGCTACAGAGGTGGG No data
971938968_971938976 3 Left 971938968 4:33189411-33189433 CCCCCACCAGCAGGTGTCACAGG No data
Right 971938976 4:33189437-33189459 GCCCCATCCTGGCAGCCCTCAGG No data
971938968_971938974 -8 Left 971938968 4:33189411-33189433 CCCCCACCAGCAGGTGTCACAGG No data
Right 971938974 4:33189426-33189448 GTCACAGGCCAGCCCCATCCTGG No data
971938968_971938978 4 Left 971938968 4:33189411-33189433 CCCCCACCAGCAGGTGTCACAGG No data
Right 971938978 4:33189438-33189460 CCCCATCCTGGCAGCCCTCAGGG No data
971938968_971938988 23 Left 971938968 4:33189411-33189433 CCCCCACCAGCAGGTGTCACAGG No data
Right 971938988 4:33189457-33189479 AGGGTGGTGGGCTACAGAGGTGG No data
971938968_971938981 7 Left 971938968 4:33189411-33189433 CCCCCACCAGCAGGTGTCACAGG No data
Right 971938981 4:33189441-33189463 CATCCTGGCAGCCCTCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971938968 Original CRISPR CCTGTGACACCTGCTGGTGG GGG (reversed) Intergenic
No off target data available for this crispr