ID: 971938972

View in Genome Browser
Species Human (GRCh38)
Location 4:33189414-33189436
Sequence TGGCCTGTGACACCTGCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971938972_971938988 20 Left 971938972 4:33189414-33189436 CCACCAGCAGGTGTCACAGGCCA No data
Right 971938988 4:33189457-33189479 AGGGTGGTGGGCTACAGAGGTGG No data
971938972_971938976 0 Left 971938972 4:33189414-33189436 CCACCAGCAGGTGTCACAGGCCA No data
Right 971938976 4:33189437-33189459 GCCCCATCCTGGCAGCCCTCAGG No data
971938972_971938987 17 Left 971938972 4:33189414-33189436 CCACCAGCAGGTGTCACAGGCCA No data
Right 971938987 4:33189454-33189476 CTCAGGGTGGTGGGCTACAGAGG No data
971938972_971938978 1 Left 971938972 4:33189414-33189436 CCACCAGCAGGTGTCACAGGCCA No data
Right 971938978 4:33189438-33189460 CCCCATCCTGGCAGCCCTCAGGG No data
971938972_971938983 7 Left 971938972 4:33189414-33189436 CCACCAGCAGGTGTCACAGGCCA No data
Right 971938983 4:33189444-33189466 CCTGGCAGCCCTCAGGGTGGTGG No data
971938972_971938981 4 Left 971938972 4:33189414-33189436 CCACCAGCAGGTGTCACAGGCCA No data
Right 971938981 4:33189441-33189463 CATCCTGGCAGCCCTCAGGGTGG No data
971938972_971938989 21 Left 971938972 4:33189414-33189436 CCACCAGCAGGTGTCACAGGCCA No data
Right 971938989 4:33189458-33189480 GGGTGGTGGGCTACAGAGGTGGG No data
971938972_971938984 8 Left 971938972 4:33189414-33189436 CCACCAGCAGGTGTCACAGGCCA No data
Right 971938984 4:33189445-33189467 CTGGCAGCCCTCAGGGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971938972 Original CRISPR TGGCCTGTGACACCTGCTGG TGG (reversed) Intergenic
No off target data available for this crispr