ID: 971938977

View in Genome Browser
Species Human (GRCh38)
Location 4:33189438-33189460
Sequence CCCTGAGGGCTGCCAGGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971938977_971938989 -3 Left 971938977 4:33189438-33189460 CCCCATCCTGGCAGCCCTCAGGG No data
Right 971938989 4:33189458-33189480 GGGTGGTGGGCTACAGAGGTGGG No data
971938977_971938988 -4 Left 971938977 4:33189438-33189460 CCCCATCCTGGCAGCCCTCAGGG No data
Right 971938988 4:33189457-33189479 AGGGTGGTGGGCTACAGAGGTGG No data
971938977_971938987 -7 Left 971938977 4:33189438-33189460 CCCCATCCTGGCAGCCCTCAGGG No data
Right 971938987 4:33189454-33189476 CTCAGGGTGGTGGGCTACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971938977 Original CRISPR CCCTGAGGGCTGCCAGGATG GGG (reversed) Intergenic
No off target data available for this crispr