ID: 971938979

View in Genome Browser
Species Human (GRCh38)
Location 4:33189439-33189461
Sequence ACCCTGAGGGCTGCCAGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971938979_971938989 -4 Left 971938979 4:33189439-33189461 CCCATCCTGGCAGCCCTCAGGGT No data
Right 971938989 4:33189458-33189480 GGGTGGTGGGCTACAGAGGTGGG No data
971938979_971938987 -8 Left 971938979 4:33189439-33189461 CCCATCCTGGCAGCCCTCAGGGT No data
Right 971938987 4:33189454-33189476 CTCAGGGTGGTGGGCTACAGAGG No data
971938979_971938988 -5 Left 971938979 4:33189439-33189461 CCCATCCTGGCAGCCCTCAGGGT No data
Right 971938988 4:33189457-33189479 AGGGTGGTGGGCTACAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971938979 Original CRISPR ACCCTGAGGGCTGCCAGGAT GGG (reversed) Intergenic