ID: 971938980

View in Genome Browser
Species Human (GRCh38)
Location 4:33189440-33189462
Sequence CACCCTGAGGGCTGCCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971938980_971938989 -5 Left 971938980 4:33189440-33189462 CCATCCTGGCAGCCCTCAGGGTG No data
Right 971938989 4:33189458-33189480 GGGTGGTGGGCTACAGAGGTGGG No data
971938980_971938987 -9 Left 971938980 4:33189440-33189462 CCATCCTGGCAGCCCTCAGGGTG No data
Right 971938987 4:33189454-33189476 CTCAGGGTGGTGGGCTACAGAGG No data
971938980_971938993 30 Left 971938980 4:33189440-33189462 CCATCCTGGCAGCCCTCAGGGTG No data
Right 971938993 4:33189493-33189515 TCCCTGTGCTCTCCCTGCAGTGG No data
971938980_971938988 -6 Left 971938980 4:33189440-33189462 CCATCCTGGCAGCCCTCAGGGTG No data
Right 971938988 4:33189457-33189479 AGGGTGGTGGGCTACAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971938980 Original CRISPR CACCCTGAGGGCTGCCAGGA TGG (reversed) Intergenic