ID: 971938982

View in Genome Browser
Species Human (GRCh38)
Location 4:33189444-33189466
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971938982_971938988 -10 Left 971938982 4:33189444-33189466 CCTGGCAGCCCTCAGGGTGGTGG No data
Right 971938988 4:33189457-33189479 AGGGTGGTGGGCTACAGAGGTGG No data
971938982_971938993 26 Left 971938982 4:33189444-33189466 CCTGGCAGCCCTCAGGGTGGTGG No data
Right 971938993 4:33189493-33189515 TCCCTGTGCTCTCCCTGCAGTGG No data
971938982_971938989 -9 Left 971938982 4:33189444-33189466 CCTGGCAGCCCTCAGGGTGGTGG No data
Right 971938989 4:33189458-33189480 GGGTGGTGGGCTACAGAGGTGGG No data
971938982_971938996 30 Left 971938982 4:33189444-33189466 CCTGGCAGCCCTCAGGGTGGTGG No data
Right 971938996 4:33189497-33189519 TGTGCTCTCCCTGCAGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971938982 Original CRISPR CCACCACCCTGAGGGCTGCC AGG (reversed) Intergenic