ID: 971938985

View in Genome Browser
Species Human (GRCh38)
Location 4:33189452-33189474
Sequence TCTGTAGCCCACCACCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971938985_971938993 18 Left 971938985 4:33189452-33189474 CCCTCAGGGTGGTGGGCTACAGA No data
Right 971938993 4:33189493-33189515 TCCCTGTGCTCTCCCTGCAGTGG No data
971938985_971938998 30 Left 971938985 4:33189452-33189474 CCCTCAGGGTGGTGGGCTACAGA No data
Right 971938998 4:33189505-33189527 CCCTGCAGTGGCTGGCATCATGG No data
971938985_971938996 22 Left 971938985 4:33189452-33189474 CCCTCAGGGTGGTGGGCTACAGA No data
Right 971938996 4:33189497-33189519 TGTGCTCTCCCTGCAGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971938985 Original CRISPR TCTGTAGCCCACCACCCTGA GGG (reversed) Intergenic