ID: 971938986

View in Genome Browser
Species Human (GRCh38)
Location 4:33189453-33189475
Sequence CTCTGTAGCCCACCACCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971938986_971938993 17 Left 971938986 4:33189453-33189475 CCTCAGGGTGGTGGGCTACAGAG No data
Right 971938993 4:33189493-33189515 TCCCTGTGCTCTCCCTGCAGTGG No data
971938986_971938996 21 Left 971938986 4:33189453-33189475 CCTCAGGGTGGTGGGCTACAGAG No data
Right 971938996 4:33189497-33189519 TGTGCTCTCCCTGCAGTGGCTGG No data
971938986_971938998 29 Left 971938986 4:33189453-33189475 CCTCAGGGTGGTGGGCTACAGAG No data
Right 971938998 4:33189505-33189527 CCCTGCAGTGGCTGGCATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971938986 Original CRISPR CTCTGTAGCCCACCACCCTG AGG (reversed) Intergenic