ID: 971938987

View in Genome Browser
Species Human (GRCh38)
Location 4:33189454-33189476
Sequence CTCAGGGTGGTGGGCTACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971938980_971938987 -9 Left 971938980 4:33189440-33189462 CCATCCTGGCAGCCCTCAGGGTG No data
Right 971938987 4:33189454-33189476 CTCAGGGTGGTGGGCTACAGAGG No data
971938977_971938987 -7 Left 971938977 4:33189438-33189460 CCCCATCCTGGCAGCCCTCAGGG No data
Right 971938987 4:33189454-33189476 CTCAGGGTGGTGGGCTACAGAGG No data
971938973_971938987 14 Left 971938973 4:33189417-33189439 CCAGCAGGTGTCACAGGCCAGCC No data
Right 971938987 4:33189454-33189476 CTCAGGGTGGTGGGCTACAGAGG No data
971938970_971938987 19 Left 971938970 4:33189412-33189434 CCCCACCAGCAGGTGTCACAGGC No data
Right 971938987 4:33189454-33189476 CTCAGGGTGGTGGGCTACAGAGG No data
971938975_971938987 -3 Left 971938975 4:33189434-33189456 CCAGCCCCATCCTGGCAGCCCTC No data
Right 971938987 4:33189454-33189476 CTCAGGGTGGTGGGCTACAGAGG No data
971938972_971938987 17 Left 971938972 4:33189414-33189436 CCACCAGCAGGTGTCACAGGCCA No data
Right 971938987 4:33189454-33189476 CTCAGGGTGGTGGGCTACAGAGG No data
971938968_971938987 20 Left 971938968 4:33189411-33189433 CCCCCACCAGCAGGTGTCACAGG No data
Right 971938987 4:33189454-33189476 CTCAGGGTGGTGGGCTACAGAGG No data
971938979_971938987 -8 Left 971938979 4:33189439-33189461 CCCATCCTGGCAGCCCTCAGGGT No data
Right 971938987 4:33189454-33189476 CTCAGGGTGGTGGGCTACAGAGG No data
971938971_971938987 18 Left 971938971 4:33189413-33189435 CCCACCAGCAGGTGTCACAGGCC No data
Right 971938987 4:33189454-33189476 CTCAGGGTGGTGGGCTACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971938987 Original CRISPR CTCAGGGTGGTGGGCTACAG AGG Intergenic
No off target data available for this crispr