ID: 971938990

View in Genome Browser
Species Human (GRCh38)
Location 4:33189484-33189506
Sequence GGAGAGCACAGGGAGAAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971938990_971939000 4 Left 971938990 4:33189484-33189506 CCCACCTTCTCCCTGTGCTCTCC No data
Right 971939000 4:33189511-33189533 AGTGGCTGGCATCATGGCAGTGG No data
971938990_971939001 5 Left 971938990 4:33189484-33189506 CCCACCTTCTCCCTGTGCTCTCC No data
Right 971939001 4:33189512-33189534 GTGGCTGGCATCATGGCAGTGGG No data
971938990_971938996 -10 Left 971938990 4:33189484-33189506 CCCACCTTCTCCCTGTGCTCTCC No data
Right 971938996 4:33189497-33189519 TGTGCTCTCCCTGCAGTGGCTGG No data
971938990_971938998 -2 Left 971938990 4:33189484-33189506 CCCACCTTCTCCCTGTGCTCTCC No data
Right 971938998 4:33189505-33189527 CCCTGCAGTGGCTGGCATCATGG No data
971938990_971939002 14 Left 971938990 4:33189484-33189506 CCCACCTTCTCCCTGTGCTCTCC No data
Right 971939002 4:33189521-33189543 ATCATGGCAGTGGGTGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971938990 Original CRISPR GGAGAGCACAGGGAGAAGGT GGG (reversed) Intergenic