ID: 971938993

View in Genome Browser
Species Human (GRCh38)
Location 4:33189493-33189515
Sequence TCCCTGTGCTCTCCCTGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971938982_971938993 26 Left 971938982 4:33189444-33189466 CCTGGCAGCCCTCAGGGTGGTGG No data
Right 971938993 4:33189493-33189515 TCCCTGTGCTCTCCCTGCAGTGG No data
971938980_971938993 30 Left 971938980 4:33189440-33189462 CCATCCTGGCAGCCCTCAGGGTG No data
Right 971938993 4:33189493-33189515 TCCCTGTGCTCTCCCTGCAGTGG No data
971938985_971938993 18 Left 971938985 4:33189452-33189474 CCCTCAGGGTGGTGGGCTACAGA No data
Right 971938993 4:33189493-33189515 TCCCTGTGCTCTCCCTGCAGTGG No data
971938986_971938993 17 Left 971938986 4:33189453-33189475 CCTCAGGGTGGTGGGCTACAGAG No data
Right 971938993 4:33189493-33189515 TCCCTGTGCTCTCCCTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971938993 Original CRISPR TCCCTGTGCTCTCCCTGCAG TGG Intergenic
No off target data available for this crispr