ID: 971938996

View in Genome Browser
Species Human (GRCh38)
Location 4:33189497-33189519
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971938985_971938996 22 Left 971938985 4:33189452-33189474 CCCTCAGGGTGGTGGGCTACAGA No data
Right 971938996 4:33189497-33189519 TGTGCTCTCCCTGCAGTGGCTGG No data
971938990_971938996 -10 Left 971938990 4:33189484-33189506 CCCACCTTCTCCCTGTGCTCTCC No data
Right 971938996 4:33189497-33189519 TGTGCTCTCCCTGCAGTGGCTGG No data
971938982_971938996 30 Left 971938982 4:33189444-33189466 CCTGGCAGCCCTCAGGGTGGTGG No data
Right 971938996 4:33189497-33189519 TGTGCTCTCCCTGCAGTGGCTGG No data
971938986_971938996 21 Left 971938986 4:33189453-33189475 CCTCAGGGTGGTGGGCTACAGAG No data
Right 971938996 4:33189497-33189519 TGTGCTCTCCCTGCAGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type