ID: 971938998

View in Genome Browser
Species Human (GRCh38)
Location 4:33189505-33189527
Sequence CCCTGCAGTGGCTGGCATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971938992_971938998 -6 Left 971938992 4:33189488-33189510 CCTTCTCCCTGTGCTCTCCCTGC No data
Right 971938998 4:33189505-33189527 CCCTGCAGTGGCTGGCATCATGG No data
971938990_971938998 -2 Left 971938990 4:33189484-33189506 CCCACCTTCTCCCTGTGCTCTCC No data
Right 971938998 4:33189505-33189527 CCCTGCAGTGGCTGGCATCATGG No data
971938991_971938998 -3 Left 971938991 4:33189485-33189507 CCACCTTCTCCCTGTGCTCTCCC No data
Right 971938998 4:33189505-33189527 CCCTGCAGTGGCTGGCATCATGG No data
971938986_971938998 29 Left 971938986 4:33189453-33189475 CCTCAGGGTGGTGGGCTACAGAG No data
Right 971938998 4:33189505-33189527 CCCTGCAGTGGCTGGCATCATGG No data
971938985_971938998 30 Left 971938985 4:33189452-33189474 CCCTCAGGGTGGTGGGCTACAGA No data
Right 971938998 4:33189505-33189527 CCCTGCAGTGGCTGGCATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971938998 Original CRISPR CCCTGCAGTGGCTGGCATCA TGG Intergenic