ID: 971939001

View in Genome Browser
Species Human (GRCh38)
Location 4:33189512-33189534
Sequence GTGGCTGGCATCATGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971938995_971939001 -6 Left 971938995 4:33189495-33189517 CCTGTGCTCTCCCTGCAGTGGCT No data
Right 971939001 4:33189512-33189534 GTGGCTGGCATCATGGCAGTGGG No data
971938990_971939001 5 Left 971938990 4:33189484-33189506 CCCACCTTCTCCCTGTGCTCTCC No data
Right 971939001 4:33189512-33189534 GTGGCTGGCATCATGGCAGTGGG No data
971938994_971939001 -5 Left 971938994 4:33189494-33189516 CCCTGTGCTCTCCCTGCAGTGGC No data
Right 971939001 4:33189512-33189534 GTGGCTGGCATCATGGCAGTGGG No data
971938991_971939001 4 Left 971938991 4:33189485-33189507 CCACCTTCTCCCTGTGCTCTCCC No data
Right 971939001 4:33189512-33189534 GTGGCTGGCATCATGGCAGTGGG No data
971938992_971939001 1 Left 971938992 4:33189488-33189510 CCTTCTCCCTGTGCTCTCCCTGC No data
Right 971939001 4:33189512-33189534 GTGGCTGGCATCATGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971939001 Original CRISPR GTGGCTGGCATCATGGCAGT GGG Intergenic