ID: 971939002

View in Genome Browser
Species Human (GRCh38)
Location 4:33189521-33189543
Sequence ATCATGGCAGTGGGTGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971938994_971939002 4 Left 971938994 4:33189494-33189516 CCCTGTGCTCTCCCTGCAGTGGC No data
Right 971939002 4:33189521-33189543 ATCATGGCAGTGGGTGCTCCAGG No data
971938991_971939002 13 Left 971938991 4:33189485-33189507 CCACCTTCTCCCTGTGCTCTCCC No data
Right 971939002 4:33189521-33189543 ATCATGGCAGTGGGTGCTCCAGG No data
971938997_971939002 -7 Left 971938997 4:33189505-33189527 CCCTGCAGTGGCTGGCATCATGG No data
Right 971939002 4:33189521-33189543 ATCATGGCAGTGGGTGCTCCAGG No data
971938992_971939002 10 Left 971938992 4:33189488-33189510 CCTTCTCCCTGTGCTCTCCCTGC No data
Right 971939002 4:33189521-33189543 ATCATGGCAGTGGGTGCTCCAGG No data
971938995_971939002 3 Left 971938995 4:33189495-33189517 CCTGTGCTCTCCCTGCAGTGGCT No data
Right 971939002 4:33189521-33189543 ATCATGGCAGTGGGTGCTCCAGG No data
971938999_971939002 -8 Left 971938999 4:33189506-33189528 CCTGCAGTGGCTGGCATCATGGC No data
Right 971939002 4:33189521-33189543 ATCATGGCAGTGGGTGCTCCAGG No data
971938990_971939002 14 Left 971938990 4:33189484-33189506 CCCACCTTCTCCCTGTGCTCTCC No data
Right 971939002 4:33189521-33189543 ATCATGGCAGTGGGTGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971939002 Original CRISPR ATCATGGCAGTGGGTGCTCC AGG Intergenic