ID: 971941944

View in Genome Browser
Species Human (GRCh38)
Location 4:33226924-33226946
Sequence TCCCACTAGGTCCCCTACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971941944_971941947 -7 Left 971941944 4:33226924-33226946 CCCATGTAGGGGACCTAGTGGGA No data
Right 971941947 4:33226940-33226962 AGTGGGAAAGTTATAAACTTAGG No data
971941944_971941948 19 Left 971941944 4:33226924-33226946 CCCATGTAGGGGACCTAGTGGGA No data
Right 971941948 4:33226966-33226988 TTATGTTTTTATGCTGACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971941944 Original CRISPR TCCCACTAGGTCCCCTACAT GGG (reversed) Intergenic
No off target data available for this crispr