ID: 971962857

View in Genome Browser
Species Human (GRCh38)
Location 4:33511345-33511367
Sequence ATGCCCATCCAGAAGGGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971962857_971962864 24 Left 971962857 4:33511345-33511367 CCTTTACCCTTCTGGATGGGCAT No data
Right 971962864 4:33511392-33511414 ACTTGGAGTAAATGCAAATGAGG No data
971962857_971962861 7 Left 971962857 4:33511345-33511367 CCTTTACCCTTCTGGATGGGCAT No data
Right 971962861 4:33511375-33511397 TAGGTCCCTTTTTTATGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971962857 Original CRISPR ATGCCCATCCAGAAGGGTAA AGG (reversed) Intergenic
No off target data available for this crispr