ID: 971965169

View in Genome Browser
Species Human (GRCh38)
Location 4:33544807-33544829
Sequence CTGGGTTTTTGTAGAGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971965169_971965174 28 Left 971965169 4:33544807-33544829 CCCTTTTCTCTACAAAAACCCAG No data
Right 971965174 4:33544858-33544880 TGAGAAAACAAACCCAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971965169 Original CRISPR CTGGGTTTTTGTAGAGAAAA GGG (reversed) Intergenic
No off target data available for this crispr