ID: 971968844

View in Genome Browser
Species Human (GRCh38)
Location 4:33595655-33595677
Sequence GTGGCAAGACACAGGCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971968844_971968849 16 Left 971968844 4:33595655-33595677 CCACCATGCCTGTGTCTTGCCAC No data
Right 971968849 4:33595694-33595716 AGAGGCCCTAAGATAACTTCTGG 0: 29
1: 39
2: 24
3: 26
4: 207
971968844_971968853 25 Left 971968844 4:33595655-33595677 CCACCATGCCTGTGTCTTGCCAC No data
Right 971968853 4:33595703-33595725 AAGATAACTTCTGGTAGCCTGGG 0: 14
1: 42
2: 34
3: 69
4: 194
971968844_971968852 24 Left 971968844 4:33595655-33595677 CCACCATGCCTGTGTCTTGCCAC No data
Right 971968852 4:33595702-33595724 TAAGATAACTTCTGGTAGCCTGG 0: 18
1: 46
2: 32
3: 62
4: 192
971968844_971968848 -2 Left 971968844 4:33595655-33595677 CCACCATGCCTGTGTCTTGCCAC No data
Right 971968848 4:33595676-33595698 ACTATTAATGCACACATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971968844 Original CRISPR GTGGCAAGACACAGGCATGG TGG (reversed) Intergenic
No off target data available for this crispr