ID: 971971434

View in Genome Browser
Species Human (GRCh38)
Location 4:33625845-33625867
Sequence TCTCATCTATTCTGTGCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971971432_971971434 18 Left 971971432 4:33625804-33625826 CCAGAATAAGTTAGGGAGAGAGT No data
Right 971971434 4:33625845-33625867 TCTCATCTATTCTGTGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971971434 Original CRISPR TCTCATCTATTCTGTGCCTG AGG Intergenic
No off target data available for this crispr