ID: 971972477

View in Genome Browser
Species Human (GRCh38)
Location 4:33637751-33637773
Sequence AAAATGCTGATAGAGAATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971972477_971972482 30 Left 971972477 4:33637751-33637773 CCCTTATTCTCTATCAGCATTTT No data
Right 971972482 4:33637804-33637826 CCAAATCTTTCAGTTTCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971972477 Original CRISPR AAAATGCTGATAGAGAATAA GGG (reversed) Intergenic
No off target data available for this crispr