ID: 971972478

View in Genome Browser
Species Human (GRCh38)
Location 4:33637752-33637774
Sequence CAAAATGCTGATAGAGAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971972478_971972482 29 Left 971972478 4:33637752-33637774 CCTTATTCTCTATCAGCATTTTG No data
Right 971972482 4:33637804-33637826 CCAAATCTTTCAGTTTCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971972478 Original CRISPR CAAAATGCTGATAGAGAATA AGG (reversed) Intergenic
No off target data available for this crispr