ID: 971972482

View in Genome Browser
Species Human (GRCh38)
Location 4:33637804-33637826
Sequence CCAAATCTTTCAGTTTCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971972477_971972482 30 Left 971972477 4:33637751-33637773 CCCTTATTCTCTATCAGCATTTT No data
Right 971972482 4:33637804-33637826 CCAAATCTTTCAGTTTCACAAGG No data
971972478_971972482 29 Left 971972478 4:33637752-33637774 CCTTATTCTCTATCAGCATTTTG No data
Right 971972482 4:33637804-33637826 CCAAATCTTTCAGTTTCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971972482 Original CRISPR CCAAATCTTTCAGTTTCACA AGG Intergenic
No off target data available for this crispr