ID: 971978346

View in Genome Browser
Species Human (GRCh38)
Location 4:33720647-33720669
Sequence GCCTCCTAGCAACTAGACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971978344_971978346 20 Left 971978344 4:33720604-33720626 CCTATTTTTATATGTTTCAAACA No data
Right 971978346 4:33720647-33720669 GCCTCCTAGCAACTAGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971978346 Original CRISPR GCCTCCTAGCAACTAGACCT TGG Intergenic
No off target data available for this crispr