ID: 971979294

View in Genome Browser
Species Human (GRCh38)
Location 4:33732865-33732887
Sequence GACAGCTCTTGGCCTGCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971979294_971979299 16 Left 971979294 4:33732865-33732887 CCAATAGCAGGCCAAGAGCTGTC No data
Right 971979299 4:33732904-33732926 GTTACCTGCAGAAGATGGCAGGG No data
971979294_971979297 11 Left 971979294 4:33732865-33732887 CCAATAGCAGGCCAAGAGCTGTC No data
Right 971979297 4:33732899-33732921 GAGCAGTTACCTGCAGAAGATGG No data
971979294_971979298 15 Left 971979294 4:33732865-33732887 CCAATAGCAGGCCAAGAGCTGTC No data
Right 971979298 4:33732903-33732925 AGTTACCTGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971979294 Original CRISPR GACAGCTCTTGGCCTGCTAT TGG (reversed) Intergenic
No off target data available for this crispr