ID: 971979298

View in Genome Browser
Species Human (GRCh38)
Location 4:33732903-33732925
Sequence AGTTACCTGCAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971979296_971979298 4 Left 971979296 4:33732876-33732898 CCAAGAGCTGTCTCTCAAAAGGA 0: 181
1: 197
2: 163
3: 130
4: 293
Right 971979298 4:33732903-33732925 AGTTACCTGCAGAAGATGGCAGG No data
971979291_971979298 25 Left 971979291 4:33732855-33732877 CCACCAAAGCCCAATAGCAGGCC No data
Right 971979298 4:33732903-33732925 AGTTACCTGCAGAAGATGGCAGG No data
971979292_971979298 22 Left 971979292 4:33732858-33732880 CCAAAGCCCAATAGCAGGCCAAG No data
Right 971979298 4:33732903-33732925 AGTTACCTGCAGAAGATGGCAGG No data
971979293_971979298 16 Left 971979293 4:33732864-33732886 CCCAATAGCAGGCCAAGAGCTGT No data
Right 971979298 4:33732903-33732925 AGTTACCTGCAGAAGATGGCAGG No data
971979294_971979298 15 Left 971979294 4:33732865-33732887 CCAATAGCAGGCCAAGAGCTGTC No data
Right 971979298 4:33732903-33732925 AGTTACCTGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971979298 Original CRISPR AGTTACCTGCAGAAGATGGC AGG Intergenic
No off target data available for this crispr