ID: 971980348

View in Genome Browser
Species Human (GRCh38)
Location 4:33742943-33742965
Sequence GGCAAAACATCAGTGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971980348_971980355 24 Left 971980348 4:33742943-33742965 CCGTCCACCACTGATGTTTTGCC No data
Right 971980355 4:33742990-33743012 TCCATTCTTCTCGATCCAGCAGG No data
971980348_971980357 25 Left 971980348 4:33742943-33742965 CCGTCCACCACTGATGTTTTGCC No data
Right 971980357 4:33742991-33743013 CCATTCTTCTCGATCCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971980348 Original CRISPR GGCAAAACATCAGTGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr