ID: 971980348 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:33742943-33742965 |
| Sequence | GGCAAAACATCAGTGGTGGA CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 971980348_971980355 | 24 | Left | 971980348 | 4:33742943-33742965 | CCGTCCACCACTGATGTTTTGCC | No data | ||
| Right | 971980355 | 4:33742990-33743012 | TCCATTCTTCTCGATCCAGCAGG | No data | ||||
| 971980348_971980357 | 25 | Left | 971980348 | 4:33742943-33742965 | CCGTCCACCACTGATGTTTTGCC | No data | ||
| Right | 971980357 | 4:33742991-33743013 | CCATTCTTCTCGATCCAGCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 971980348 | Original CRISPR | GGCAAAACATCAGTGGTGGA CGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||