ID: 971984311

View in Genome Browser
Species Human (GRCh38)
Location 4:33800973-33800995
Sequence GGTTTTCTTCCCAAGAGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971984307_971984311 2 Left 971984307 4:33800948-33800970 CCAATTGTGTTCATTCCTTAACA No data
Right 971984311 4:33800973-33800995 GGTTTTCTTCCCAAGAGACTGGG No data
971984304_971984311 29 Left 971984304 4:33800921-33800943 CCACCTTTTCTGATTTCCAGTAG No data
Right 971984311 4:33800973-33800995 GGTTTTCTTCCCAAGAGACTGGG No data
971984305_971984311 26 Left 971984305 4:33800924-33800946 CCTTTTCTGATTTCCAGTAGAAC No data
Right 971984311 4:33800973-33800995 GGTTTTCTTCCCAAGAGACTGGG No data
971984306_971984311 13 Left 971984306 4:33800937-33800959 CCAGTAGAACACCAATTGTGTTC No data
Right 971984311 4:33800973-33800995 GGTTTTCTTCCCAAGAGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971984311 Original CRISPR GGTTTTCTTCCCAAGAGACT GGG Intergenic
No off target data available for this crispr