ID: 971993354

View in Genome Browser
Species Human (GRCh38)
Location 4:33930768-33930790
Sequence GCCAAGTTTATCAAATGATT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971993354_971993357 7 Left 971993354 4:33930768-33930790 CCGAATCATTTGATAAACTTGGC No data
Right 971993357 4:33930798-33930820 GCAGAATTTGGAATTACCTCTGG No data
971993354_971993355 -5 Left 971993354 4:33930768-33930790 CCGAATCATTTGATAAACTTGGC No data
Right 971993355 4:33930786-33930808 TTGGCCTAGAATGCAGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971993354 Original CRISPR GCCAAGTTTATCAAATGATT CGG (reversed) Intergenic
No off target data available for this crispr