ID: 971993357

View in Genome Browser
Species Human (GRCh38)
Location 4:33930798-33930820
Sequence GCAGAATTTGGAATTACCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971993354_971993357 7 Left 971993354 4:33930768-33930790 CCGAATCATTTGATAAACTTGGC No data
Right 971993357 4:33930798-33930820 GCAGAATTTGGAATTACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971993357 Original CRISPR GCAGAATTTGGAATTACCTC TGG Intergenic
No off target data available for this crispr