ID: 971995221

View in Genome Browser
Species Human (GRCh38)
Location 4:33955789-33955811
Sequence GTGGCCCTGTTACTCCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971995213_971995221 12 Left 971995213 4:33955754-33955776 CCTTCATTGGGTTCAGGAACTGG No data
Right 971995221 4:33955789-33955811 GTGGCCCTGTTACTCCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971995221 Original CRISPR GTGGCCCTGTTACTCCAAGC AGG Intergenic
No off target data available for this crispr